Nov 302005
 

Palindromati
by Fernando Castro-Chavez

Abstract– This article describes a family of artificial heterotranscripts (RNA chimaeras) composed by thousands of Genbank sequences containing fragments or the complete EcoRI-like adapter acting as the palindrome linker ctcgtgccgaattcggcacgag, binding together two or more genes that may be produced by different chromosomes. This happens due to current methodologies producing the reported sequences, found in the Genbank, in Affymetrix microarrays, and in many published articles reporting or using those sequences that include the EcoRI-like linker inside coding regions, and/or 5’UTR or 3’UTRs mRNA sites. This EcoRI-like linker and its heterotranscripts are here deemed as experimental artifacts, characterization that can be helpful to prevent errors, both in the studies of molecular mechanisms and in the drug discovery process.

The full paper is available below:
Palindromati

Nov 282005
 

From Uncommon Descent. I think Rhodes mistakenly left this out.
“If creation science– with all its muddled inconsistencies– is imposed today, what will be required tomorrow? A pre-Copernican universe? Spontaneous generation? Darwinian evolution? Who knows? These once established the limits of human speculation and were required by those who controlled the curriculum.

Nov 252005
 

The University of Kansas is planning to teach a course on Intelligent Design as mythology. I had always opposed the teaching of ID as anything other than science. Teaching ID in anything other than a science course only reinforces the perception to the general public that ID is nothing more than personal belief. The intention of Professor Paul Mirecki to teach ID as mythology in a religious course is precisely that, to undermine the credibility of ID. His intention is far more malicious as it was discovered in one of his email.

“The fundies want it all taught in a science class, but this will be a nice slap in their big fat face by teaching it as a religious studies class under the category ‘mythology,'” Mirecki wrote.

As a fundamentalist, I find it very offensive that he is using the platform of a university to create a mock course just to slap my face. But this is much more serious than just some personal attack on Christian fundamentalists.

I think the Atheistic Darwinians are beginning to show their true nature. I’ve written about this before in Atheism’s Trojan Horse. The Atheistic Darwinians don’t have a problem with ID. They are not even interested in science. Their main focus is to crush the fundies and not give any grounds for the Christians to belief in their mythology. Make no mistake; this is a war of Worldviews for sure. It is not about the purity of science as some Darwinists have claimed. Continue reading »

HAPPY THANKSGIVING

 Uncategorized  Comments Off on HAPPY THANKSGIVING
Nov 242005
 

Thank you to all those who have taken their time and effort to contribute to this blog. Have a good THANKSGIVING everyone.

Nov 232005
 

A Southern California Christian high school sued the University of California (UC) in late August, accusing the ten-campus system of discriminating against the high school’s students by not allowing certain courses taught from a Christian viewpoint to fulfill admission requirements.
I predicted this was a real threat. What we need is an agnostic admission program based on standardized tests like SAT and competency of the applicants. Darwinians cannot be trusted to be fair.

Nov 172005
 

I have published several papers now beginning in 1984 questioning the Darwinian paradigm. To my knowledge only one acknowledgement ever appeared in the professional literature. That was in response to my first paper in the Journal of Theoretical Biology – Semi-meiosis as an evolutionary mechanism, 111: 725-735, 1984. I responded to that letter to the editor in a letter to the editor of the same journal. Since then no citations to my work have appeared in the professional (refereed) literature. For that reason I have turned to the internet as a venue for presenting my ideas. The responses have been quite varied and primarily negative as anyone can learn by exploring my published papers on Google.

One of my contentions is that all creative evolution is finished. By that I mean the production of true speceis and any of the higher taxonomic categories. I was certainly not the first to make such a suggestion as it had been proposed by Robert Broom, Pierre Grasse and, of all people, Julian Huxley in his 1942 book “Evolution: The Modern Synthesis.” I recently recounted this in my manuscript “Julian Huxley’s Confession” which can be found at ISCID’s “brainstorms” forum.

What I want to do here is to present a few challenges as follows.
Continue reading »

Nov 142005
 

I don’t want to give the impression that I am trying to attack Dr. Collins. I am happy to know that he is a brother in Christ. However, I feel that he is seriously in error both theologically and, more importantly in the current context, scientifically. Therefore while I respect his prerogative to practice his faith in anyway that he sees fit, I must oppose his attempt to peddle Darwinism to other Christians.

As I’ve mentioned in a previous post, I hope Dr. Collins would make a 180 degrees turnaround and fight for ID to have a place at the scientific table. I am not asking him to accept the theory of ID, just his support of a scientific debate.

I want to contrast Dr. Collins’ disparaging of ID with another prominent scientist Dr. Schaefer’s support of ID.

Collins: Darwin’s theory is accepted by virtually all mainstream scientists, is not on the brink of collapse (despite what some Christians may say) but is instead supported by “rock solid” evidence from both the fossil record and DNA.

Continue reading »

Nov 112005
 

Darwinian distortion of ID : ID holds that the universe is so complex that it must have been created by a higher power.

DI’s definition : The theory of intelligent design holds that certain features of the universe and of living things are best explained by an intelligent cause, not an undirected process such as natural selection.

My definition : ID says Darwinian evolution has been shown empirically to be incapable of producing the complexity of life and the evidence is indicative of design.

The subtle Darwinian deception is to make ID a statement of subjective and even whimsical view of Darwinian evolution. In reality, ID is simply acknowledging that after 150 years since the acceptance of Darwin’s theory, there is still no evidence to support it. There is insufficient evidence from paleontology, research (here, here, here, here) and simulation.

Darwinian distortion of ID : Subjective, fabricates a straw man.

ID definition : Strictly scientific, empirically based.

Nov 102005
 

The Patriot-News

BACKLASH
Thursday, November 10, 2005
Pennsylvanians provided a memorable off-year election by voting not to retain a Supreme Court justice for the first time ever and by ousting eight incumbent Dover School Board members who achieved international notoriety by provoking a renewed debate over the validity of the theory of evolution.

I just have two words. “School Vouchers” Let the Atheistic Darwinists keep their tyrannical indoctrination to their own children, they have no right to force indoctrinate ours.

Two things can be accomplished with vouchers. 1. Our children will get a better education and we can all get the kind of education that we want. 2. This will setup a natural competition between ID and Darwinian education. We will know once and for all which group will become better scientists. Although the latter will depend on universities be blind to where applicants come from to avoid Darwinian bigotry.