Monthly Archives: November 2005

Archive of posts published in the specified Month

Evolution and the ID Wars

This week’s program on Reasons To Believe is on “Evolution and the ID Wars” . The topic touched briefly on Skeptical Inquirer’s November issue in the same name.

fdocc Featured in ISCID – Artificial Heterotranscripts (RNA chimaeras)

Palindromati by Fernando Castro-Chavez Abstract– This article describes a family of artificial heterotranscripts (RNA chimaeras) composed by thousands of Genbank sequences containing fragments or the complete EcoRI-like adapter acting as the palindrome linker ctcgtgccgaattcggcacgag, binding together two or more genes that may be…

The Former President of Cornell

From Uncommon Descent. I think Rhodes mistakenly left this out. “If creation science– with all its muddled inconsistencies– is imposed today, what will be required tomorrow? A pre-Copernican universe? Spontaneous generation? Darwinian evolution? Who knows? These once established the limits of human speculation…

Lawrence Krauss and Paul Mirecki on Teaching Intelligent Design

The University of Kansas is planning to teach a course on Intelligent Design as mythology. I had always opposed the teaching of ID as anything other than science. Teaching ID in anything other than a science course only reinforces the perception to the…

HAPPY THANKSGIVING

Thank you to all those who have taken their time and effort to contribute to this blog. Have a good THANKSGIVING everyone.

Darwinians Cannot Be Trusted

A Southern California Christian high school sued the University of California (UC) in late August, accusing the ten-campus system of discriminating against the high school’s students by not allowing certain courses taught from a Christian viewpoint to fulfill admission requirements. I predicted this…

Is evolution finished?

I have published several papers now beginning in 1984 questioning the Darwinian paradigm. To my knowledge only one acknowledgement ever appeared in the professional literature. That was in response to my first paper in the Journal of Theoretical Biology – Semi-meiosis as an…

Francis Collins vs. Henry F. Schaefer

I don’t want to give the impression that I am trying to attack Dr. Collins. I am happy to know that he is a brother in Christ. However, I feel that he is seriously in error both theologically and, more importantly in the…

What is Intelligent Design? (Again)

Darwinian distortion of ID : ID holds that the universe is so complex that it must have been created by a higher power. DI’s definition : The theory of intelligent design holds that certain features of the universe and of living things are…

Pro Intelligent Design School Board Ousted

The Patriot-News BACKLASH Thursday, November 10, 2005 Pennsylvanians provided a memorable off-year election by voting not to retain a Supreme Court justice for the first time ever and by ousting eight incumbent Dover School Board members who achieved international notoriety by provoking a…